ABSTRACT
Objective To understand the intention to quit smoking and its influencing factors among current smokers in Gansu Province, so as to provide scientific basis for tobacco control. Methods A multi-stage sampling method was used to extract current smokers aged 15-69 years, and a face-to-face survey was conducted using the questionnaire on smoking among residents in China. Intention to quit smoking between current smokers with different characteristics was analyzed. Logistic regression was used to explore influencing factors of intention to quit smoking. Results The intention of current smokers to quit smoking in Gansu Province was 16.4% (95% CI:15.5%-17.3%). Multivariate logistic regression analysis showed that current smokers who were in rural areas (OR=1.199, 95% CI:1.022-1.408, P=0.026); family smoking prohibited (OR=1.767, 95% CI: 1.273-2.454, P=0.001), medical staff discouraged smoking within 12 months (OR=1.599, 95% CI:1.359-1.842, P<0.001), visited smoking clinics (OR=3.089, 95% CI:2.031-4.698, P<001), higher educational level of junior high school, senior high school and college or above (OR=1.383, 95% CI:1.101-1.736; OR=1.627, 95% CI:1.252-2.116; OR=1.374, 95% CI:1.009-1.873, all P<0.05), tobacco hazards knowledge with higher scores of 1-, 3- and 5-6 (OR=1.248, 95% CI:1.030-1.514; OR=1.574, 95% CI:1.289-1.922; OR=2.288, 95% CI:1.879-2.786, all P<0.05) were more likely to quit smoking; furthermore, smokers aged 20-, 30- years or smoking 20-, 30- years had a lower chance of quit smoking (all P<0.05). Conclusions The intention of current smokers to quit smoking in Gansu province is generally not high. In the future, knowledge of tobacco hazards should be further promoted, medical staff should provide more smoking cessation services during the treatment process, and more smoking cessation clinics should be established.
ABSTRACT
BACKGROUND: As a cytokine highly expressed in internal organs, visfatin could be used as a biomarker of systemic inflammation response for chronic obstructive pulmonary diseases, but few studies have reported the use of visfatin in severe pneumonia. The present study was undertaken to determine the plasma levels of visfatin in patients with severe pneumonia. METHODS: A total of 70 patients, including 40 patients with severe pneumonia (group A) and 30 patients with non severe pneumonia (group B) who had been admitted to the ICU from June 2009 to June 2010, were enrolled in this prospective study. And another 30 healthy physical examinees served as healthy controls (group C). Patients were excluded if they suffered from severe diseases of the heart, brain and kidney, cancers, autoimmune diseases, or received special treatment in the latest month. The plasma levels of visfatin, IL-6, IL-8 and TNF-α were measured by ELISA, while the level of CRP was determined by immuneturbidimetry, and the routine blood test was performed. Blood gas analysis and Acute Physiology and Chronic Health Evaluation II (APACHE II) were performed in patients with pneumonia. Comparisons between the groups were conducted by Student's t test, ANOVA or nonparametric test. Correlation analysis was carried out by Pearson's correlation test or Spearman's rank-order correlation test. RESULTS: The plasma level of visfatin in group A was significantly higher than that in groups B and C (P<0.001), and the level of visfatin in group B was significantly higher than that in group C (P<0.001). The plasma level of visfatin was positively correlated with CRP, TNF-α, APACHE II and PMN% in patients with severe pneumonia (rho=0.653, r=0.554, r=0.558, r=0.484, respectively, P<0.05 for all), while it was negatively correlated with PaO2 and PaO2/FiO2 (rho=?0.422, r=?0.543, respectively, P<0.05 for all). CONCLUSION: Visfatin may be involved in the systematic inflammation response in patients with severe pneumonia as a pro-inflammatory cytokine, and it is valuable in assessing the severity of pneumonia..
ABSTRACT
Objective To determine,the clinical significance of serum myocardial enzymes (Mb,cTNI, CK,CK-Mb,AST,LDH) in the classification of the disease severity of non-cardiogenic critically-ill patients. Compared with APACHEⅡscore concerned as the standard diagnosis of the critical ills,these biomarkers were investigated for the evaluation possibility of the degree and the prognosis of the critical ills.Method Patients admitted to our EICU were consecutively collected for the research from April to December in 2005 and the myocardial enzymes,and routine serum biochemical test and APACHEⅡscore were detected simultaneously.All the patients were classified to three groups according to the APACHEⅡscore (mild group,APACHEⅡ25) and two groups (survive group and death group) according to the prognosis.All the patients were followed up till recovery/discharge or death. Covariance,Wilcoxon and x~2 were used for the statistical analysis.Results The myocardial enzymes rose when the disease deteriorated and the APACHEⅡscore went up.AST,LDH,CK,CK-Mb,Mb were significantly different in the three groups according to the APACHEⅡscore (P
ABSTRACT
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Subject(s)
Animals , Agkistrodon , Genetics , Amino Acid Sequence , Base Sequence , Cloning, Molecular , Crotalid Venoms , Genetics , DNA, Complementary , Chemistry , Genetics , Escherichia coli , Genetics , Metalloendopeptidases , Genetics , Molecular Sequence Data , Recombinant Proteins , Reverse Transcriptase Polymerase Chain Reaction , Sequence Analysis, DNA , Sequence Homology, Nucleic Acid , Thrombin , GeneticsABSTRACT
Spider dragline silk is synthesized in special gland named major ampulate (MA) gland. The MA glands were dissected from the abdomen of the spiders Nephila clavata and the total RNA was extracted by the TRIZOL. The cDNA of dragline silk was amplificated by RT-PCR (reverse transcription polymerase chain reaction), multiplex PCR and cloned. PCR identification, restriction analysis and DNA sequence analysis were carried out to verify the recombinant plasmids. The codon usage frequencies of the cloned cDNA were added up, and the predicted amino acid sequence was compared with Spidroin2 of Nephila clavipes. Predicted secondary structure of the predicted amino-acid sequence was analysized by DNAStar software. All results showed that the cloned cDNA we got (GenBank Accession No. AF441245) was the very fragment of spider dragline silk Spidroin2 cDNA.